GlitterPrettyGlitz
GlitterPrettyGlitz GlitterPrettyGlitz
  • 01-05-2018
  • Mathematics
contestada

Can somebody help me?? i need help asap! please i have to finish this today!! help meee!

Can somebody help me i need help asap please i have to finish this today help meee class=

Respuesta :

mayadc821
mayadc821 mayadc821
  • 01-05-2018
To solve this problem, you just have to subtract the volume of the glass box from the volume of the shipping container.  Volume is calculated by multiplying width by length by height.

The glass box's volume:  7 * 9 * 12 = 756 in³

The shipping container's volume:  10 * 10 * 15 = 1500 in³

The difference between these values:  1500 - 756 = 744 in³

744 in³ of space will contain Styrofoam peanuts.
Answer Link

Otras preguntas

Failure to incorporate _______ can easily lead to _______. Would the answer be: citations, plagiarism?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
Step by step directions Square root for 480
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
How did the mountains in Greece contribute to the rise of city-states?
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
the bombing of Hiroshima and Nagasaki resulted in
Please help with Algebra 1