Seudónimo Seudónimo
  • 04-03-2018
  • Mathematics
contestada

How do I find X in this math problem?

How do I find X in this math problem class=

Respuesta :

sqdancefan
sqdancefan sqdancefan
  • 04-03-2018
You can use the fact that an exterior angle of a triangle is equal to the sum of the opposite interior angles.

97 +x = 64 +27 . . . . the relevant geometric relationship
x = 64 +27 -97 . . . . subtract 97
x = -6 . . . . . . . . . . . do the arithmetic
Answer Link

Otras preguntas

In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what is the percent change from 70 to 56?
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
who was the founder of Pennsylvania?
why did russia have revolution in 1917?
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
What are the factors of 6x + 24?