stefcortez83 stefcortez83
  • 02-02-2018
  • Mathematics
contestada

Which is true 159.399>159.410, 11.0=11.000, 5.9 <5.899n 1,4036>1.7001

Respuesta :

HMcCabe2020 HMcCabe2020
  • 05-02-2018
11.0= 11.000 only if they don't have anymore numbers behind those seros

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
Tu as quels cours le jeudi matin?
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
How do you put allele in a sentence
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
Why did the American public mostly oppose joining the League of Nations after WWI?
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!