ammaarahwilliams1 ammaarahwilliams1
  • 04-04-2021
  • Health
contestada

Discuss 2 ways cultural views can affect relationships

Respuesta :

clementineyeet
clementineyeet clementineyeet
  • 04-04-2021
in india you can only marry people of the same status as you. if they are a lower status than you, you may not marry them, because it is forbidden
Answer Link

Otras preguntas

Graph the first six terms of a sequence where a1 = -10 and d = 3.
where are the three parts of an atom located
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
accurate estimation 719-348
Explain who or what "Año Viejo" is and its significance.
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5