borreronayla borreronayla

01-06-2020
Mathematics

contestada

If the lines of a system of equations never intersect then, then the system has no____

Respuesta :

rbruton59 rbruton59

01-06-2020

Answer:

solution

Step-by-step explanation:

Answer Link

Otras preguntas

Elsie loves to garden the width of her current garden is half the length. Elsie wants to increase both the width and the length of her garden to triple the size

Cynthia paid $11 for two notebooks and one pack of pencils. The pack of pencils costs $4. What equation can she write to find the price of each notebook?

The artists of the Hudson River School were credited with paintings that reflected what aspect of American society?

How has the school closing effected your daily life? How do you feel about learning math online? Be sure to mention some benefits and poential challenges you f

Where is the Ob River in Asia?northeastwestsouth

What is the root of regicide

The ability to sense and manage your own feeling as well as those of others is called——— intelligence? All

If the pound sterling appreciates against the U.S. dollar, England buys _____ U.S. goods, causing the U.S. aggregate demand curve to shift to the _____. more; l

I ______ gotten to the hotel two hours ago, but my flight was delayed. should have should should of

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA