rapidwings720 rapidwings720
  • 04-05-2020
  • English
contestada

The genie gave Cisco Ramon three wishes.
Select the active voice verb in the sentence below

Respuesta :

dianaw
dianaw dianaw
  • 04-05-2020

Answer:

Gave

Explanation:

Answer Link
absisawesomeT
absisawesomeT absisawesomeT
  • 11-05-2020

Answer:

Cisco Ramon from the Flash. YEs

Explanation:

Answer Link

Otras preguntas

help me please it’s for geometry
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
True or false? Profit is found by subtracting operating costs from total revenue.
What is the molarity of 0.65 mol NaF dissolved in a total volume of 0.50 liters?
Create an expression that is equivalent to 8(x+5) without using parenthese
find the solution to the system of equations: 3x +2y = 16 y=-7x+19
How do I solve -7+m=8?
Axel used the vertical line test on this graph, and decided it is a function because the vertical line only passes through one point, (3, 0). On a coordinate pl
Which expressions are equivalent to x^1.4
A wrench 0.500m long is applied to a nut with a force of 80.0N. Because of the cramped space, the force must be exerted upward and at an angle of 60.0 degrees,