lizzy0916 lizzy0916

03-05-2020
History

contestada

How did The Atlantic Ocean trade eventually lead to the crossing of the Pacific Ocean?

Respuesta :

iamascammer890 iamascammer890

03-05-2020

Answer:

Panama Canal

Explanation: When the canal was created ships could go from the atlantic to the Pacific without having to go around a long detour

Answer Link

Otras preguntas

4 (2x-6)=10x-6. solve for x

i will mark as brainiest you answer this easy question

The vessels that are responsible for carrying blood away from the heart are

What is the solution of the system of equations? y = –2x + 8 y = x – 4

Adair needs $21,150 to purchase a boat. How much money will you need to invest today in a savings account earning 3.2% interest, compounded monthly, to have en

If you attended the us public high school the highest status crowds were probably the

What’s the answer to #12? and why

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Use factoring to simplify the expression x^2-x-6/x-3 assume that x does not equal 3

when she turned 18, Kaitlyn purchased 130 shares of stock A for $47 per share; 68 shares of stock B for $32 per share; 71 shares of stock C for $102 per shar