Seudónimo Seudónimo
  • 01-12-2019
  • Physics
contestada

Soil aeration helps plants by _____.

Respuesta :

jakeria18
jakeria18 jakeria18
  • 01-12-2019
To ensure moisture distribution and get airflow to the roots
Answer Link
lalloronamishijos
lalloronamishijos lalloronamishijos
  • 01-12-2019

Answer:

Soil aeration

Explanation:

reducing the ability of water, oxygen and other key nutrients to penetrate plant and tree root systems, and also limits the ability of root systems to expand and strengthen

Answer Link

Otras preguntas

What’s the answer to #12? and why
What is a sample vs a population
Find the equation of a line passing through the point (−3, 5) and making an angle of 16° with the x-axis
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Who can become an American citizen through the process of naturalization?
The root word graph means to _____. speak, write, read
One year ago liz was three times as old as her brother jack. in two years she'll be only twice as old as jack. how old are liz and jack now?
What did Theodore Roosevelt do before he was elected president at the age of 42?
Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can be removed from the body. explain how this process works in
What is the solution to the following equation? 5(2x − 14) + 23 = 7x − 14 11 14 30 36