Seudónimo Seudónimo
  • 02-05-2016
  • Mathematics
contestada

Can u help with this one u know who u are

Can u help with this one u know who u are class=

Respuesta :

HMRegan02
HMRegan02 HMRegan02
  • 02-05-2016
It's the one on the top righr, -2/9 w + 2/15.
Answer Link
Eesabella
Eesabella Eesabella
  • 02-05-2016
1/3(2/5-2/3w)

1/3*2/5-1/3*2/3w

2/15-2/6w

2/15-1/3w

Final Answer: 2/15-1/3w


Answer Link

Otras preguntas

The picture shows the cross section of a tree. During what year of this tree's life was there a severe drought? A First year B Second year C Fifth year D Sixth
Which set of integers is in order from greatest to least?-6,-12,1,4,7-12,-6,1,4,77,4,1,-6,-127,4,1,-12,-6​
How did the 7 year was negatively affect the colonies?
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
As an estimation we are told £3 is €4. Convert €36 to pounds.
Type the following using exponents 2×2×3×3×3
how does choreographer used time?
Beyonce has a straight hairline, which is a recessive trait. Bruno also has a straight hairline. What is the chance that their child would have a widow’s peak?
What did the Second Continental Congress accomplish? O It convinced King George to reduce taxes on the colonies. O It sent Benjamin Franklin to France to negoti
No irrational numbers are whole numbers. True or false? Explain your answer