natetheman7740
natetheman7740 natetheman7740
  • 01-02-2019
  • Mathematics
contestada

What is the value of x?

What is the value of x class=

Respuesta :

HecptyAura
HecptyAura HecptyAura
  • 01-02-2019
Its 12.

10x-20+6x+8=180
16x-12=180
16x=192
x=12
Answer Link
Аноним Аноним
  • 01-02-2019

Answer:

X equals 12!

Step-by-step explanation

You just do 10 times 12 equals 120 so 120 minus 20 equals 100

Then 6 times 12 is 72 plus 8 is 80

100 plus 80 equals 180

Answer Link

Otras preguntas

Adair needs $21,150 to purchase a boat. How much money will you need to invest today in a savings account earning 3.2% interest, compounded monthly, to have en
Using the images or terms, describe how parts of a cell interact to export proteins.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
which is a reason that protists are difficult to classify
Really need some helpUse the diagram below. Write AD/AB in simplest form.
what's the ph of citric acid
What is [tex] \frac{1}{x+2} +\frac{6}{x-5} [/tex] equal to?Please show most of your work!!!Thank you!!
Business contracts or marriage licenses are found in which stage of relational development
For some time, the English had little interest in colonizing for what two reasons?
List and briefly describe each of the five strength training principles. (Site 1)